Coriell Institute for Medical Research
Coriell Institute of Medical Research
  • Request a Quote
  • Donate
  • Login
  • View Cart
Sample Catalog | Custom Services | Core Facilities | Genomic Data Search
  • Biobank
    • NIGMS
    • NINDS
    • NIA
    • NHGRI
    • NEI
    • Allen Cell Collection
    • Rett Syndrome iPSC Collection
    • Autism Research Resource
    • HD Community Biorepository
    • CDC Cell and DNA
    • J. Craig Venter Institute
    • Orphan Disease Center Collection
    • All Biobanks
  • Research
    • Overview
    • Meet Our Scientists
      • Our Faculty
      • Our Scientific Staff
    • Camden Cancer Research Center
    • Epigenetic Therapies SPORE
    • Core Facilities
    • Epigenomics
    • Camden Opioid Research Initiative (CORI)
    • The Issa & Jelinek Lab
    • The Jian Huang Lab
    • The Luke Chen Lab
      • The Lab
      • The Team
      • Publications
    • The Scheinfeldt Lab
    • The Shumei Song Lab
    • The Nora Engel Lab
      • The Lab
      • The Team
      • Publications
    • Publications
  • Services
    • Overview
    • Biobanking Services
      • Core Services
      • Project Management
      • Research Support Services
      • Sample Cataloging
      • Sample Collection Kits
      • Sample Data Management
      • Sample Distribution
      • Sample Management
      • Sample Procurement
      • Sample Storage
    • Bioinformatics and Biostatistics Services
    • Cellular and Molecular Services
      • Biomarker Research Solutions
      • Cell Culture
      • Nucleic Acid Isolation and Quality Control
    • Clinical Trial Support
      • Overview
      • Sample Collection
      • Data Management
      • Sample Processing and QC
      • Storage and Distribution
      • Biomarker Services
      • Data Analaysis
    • Core Facilties
      • Overview
      • Animal and Xenograft
      • Bioinformatics and Biostatistics
      • Cell Imaging
      • CRISPR Gene Engineering
      • Flow Cytometry and Cell Sorting
      • Genomics and Epigenomics
      • iPSC - Induced Pluripotent Stem Cells
      • Organoids
    • Coriell Marketplace
    • Genomic, Epigenomic and Multiomics Services
    • Stem Cells and iPSC Services
      • Core Services
      • Reprogramming
      • Characterization and Quality Control
      • Differentiated Cell Lines
      • iPSC-Derived Organoids
      • iPSC Expansion
      • iPSC Gene Editing
  • Ordering
    • Stem Cells
    • Cell Lines
    • DNA and RNA
    • Featured Products
      • FFPE
      • HMW DNA
    • Genomic Data Search
    • Search by Catalog ID
    • Help
      • Create Account
      • Order Online
      • Ordering FAQ
      • FAQs/Culture Instructions
      • Reference Materials
        • Biobanks
        • NIGMS Repository
        • NHGRI Repository
        • NINDS Repository
        • NIA Repository
        • NIST
        • GeT-RM
      • Secondary Distribution Policies
      • MTA Assurance Form
      • Shipment Policy
      • Contact Customer Service
  • About Us
    • About Coriell
    • Meet Our Team
    • Meet Our Board
    • Education
      • Science Fair
      • Summer Experience
      • Outreach
      • Research Program Internship
    • Press Room
      • Press Releases
      • Coriell Blog
      • Annual Report
    • Careers
      • Working at Coriell
    • Giving
      • Donate
      • Giving FAQ
    • Contact Us
    • Notices
      • Legal Notice
      • IBC Minutes
  • Login View Cart
search submit
CH00018 Plasmid

Description:

HTT-Q73, MIX, 1-90, HUMAN
HUNTINGTON DISEASE; HD

Affected:

No Data

Sex:

No Data

Age:

No Data

  • Overview
  • Characterizations
  • Phenotypic Data
  • External Links
  • Culture Protocols

Overview

back to top
Repository HD Community Biorepository
Quantity 20 µg
Quantitation Method Please see our FAQ
Certain Third Party Licensing Requirements Invitrogen License for Cat# V790.20
Alias E1mixQ73m
Sample Source CHDI Foundation, Inc.
Species Homo sapiens
Common Name Human
Remarks DNA corresponding to the Exon 1 (1-90) human sequence of the Huntingtin (Htt) gene containing 73 polyglutamine repeats translated from a mixed codon. mix= [CAG, CAA, CAG, CAA, CAA]n

Characterizations

back to top
Remarks DNA corresponding to the Exon 1 (1-90) human sequence of the Huntingtin (Htt) gene containing 73 polyglutamine repeats translated from a mixed codon. mix= [CAG, CAA, CAG, CAA, CAA]n
Construct Name E1mixQ73m
Insert Length 450
Vector pcDNA3.1
Concentration 67.6 ng/ml
Sequence CTGCAGATAAACACCACCATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCT
CAAGTCCTTCCAACAGCAGCAACAGCAACAACAGCAGCAACAGCAACAACAGCAGCAAC
AGCAACAACAGCAGCAACAGCAACAACAGCAGCAACAGCAACAACAGCAGCAACAGCAA
CAACAGCAGCAACAGCAACAACAGCAGCAACAGCAACAACAGCAGCAACAGCAACAACA
GCAGCAACAGCAACAACAGCAGCAACAGCAACAACAGCAGCAACAGCAACAACCGCCAC
CGCCGCCGCCGCCGCCGCCGCCTCCTCAGCTTCCTCAGCCGCCGCCGCAGGCACAGCCG
CTGCTGCCTCAGCCGCAGCCGCCCCCGCCGCCGCCCCCGCCGCCACCCGGCCCGGCTGT
GGCTGAGGAGCCGCTGCACCGACCA
Cloning Information The construct is engineered with a "PmeI" on the 5' and NotI on the 3' prime. Cloning site: fused EcoRV/PmeI at 5' and Not I at 3', RV and PmeI were deleted.

Phenotypic Data

back to top
Remarks DNA corresponding to the Exon 1 (1-90) human sequence of the Huntingtin (Htt) gene containing 73 polyglutamine repeats translated from a mixed codon. mix= [CAG, CAA, CAG, CAA, CAA]n

External Links

back to top
Gene Cards HD
HD (verified)
Gene Ontology GO:0003714 transcription corepressor activity
GO:0005215 transporter activity
GO:0005515 protein binding
GO:0005625 soluble fraction
GO:0005634 nucleus
GO:0005737 cytoplasm
GO:0006915 apoptosis
GO:0006917 induction of apoptosis
GO:0007610 behavior
GO:0008017 microtubule binding
GO:0009405 pathogenesis
GO:0009887 organogenesis
NCBI Gene Gene ID:3064
NCBI GTR 143100 HUNTINGTON DISEASE; HD
OMIM 143100 HUNTINGTON DISEASE; HD
Website Invitrogen website

Culture Protocols

back to top
DNA corresponding to the Exon 1 (1-90) human sequence of the Huntingtin (Htt) gene containing 73 polyglutamine repeats translated from a mixed codon. mix= [CAG, CAA, CAG, CAA, CAA]n
Remarks DNA corresponding to the Exon 1 (1-90) human sequence of the Huntingtin (Htt) gene containing 73 polyglutamine repeats translated from a mixed codon. mix= [CAG, CAA, CAG, CAA, CAA]n
PDF Vector Map
Plasmid Collection Screening and Propagation
Supplement -
Pricing
Commercial:
$50.00USD
Academic &
Non-profit:
$50.00USD
Add to Cart
How to Order
  • Ordering Instructions
  • Material Transfer Agreement

Our mission is to prevent and cure disease through biomedical research.

CONTACT US

CUSTOMER SERVICE
customerservice@coriell.org (800) 752-3805 • (856) 757-4848
Subscribe to our newsletter here

Coriell Institute for Medical Research
403 Haddon Avenue Camden, NJ 08103, USA (856) 966-7377

Ⓒ 2025 Coriell Institute. All rights reserved.

  • Facebook
  • Linkedin
  • Youtube